GENEALOGY-DNA-L Archives
Archiver > GENEALOGY-DNA > 2009-12 > 1259868354
From: Nelda Percival <>
Subject: [DNA] Segments and percentages
Date: Thu, 3 Dec 2009 13:25:54 -0600
References: <8CC425DA2BBC091-1BAC-939B@webmail-m068.sysops.aol.com>
In-Reply-To: <8CC425DA2BBC091-1BAC-939B@webmail-m068.sysops.aol.com>
Hi,
The question is:
if I had chromosome #17 for 1 segment at 10%, will that indicate to me what generation of ancestors I should look at? for a common ancestor with a 5th cousin?
If this can be deterimined what is the formula?
Ok second question say I'm a miture of N. European and NA. can I tell from the chromosome, segment and percentage what generation the NA comes from??
Nelda
My websites : http://freepages.folklore.rootsweb.com/~bonsteinandgilpin/
> To:
> Date: Thu, 3 Dec 2009 13:29:08 -0500
> From:
> Subject: Re: [DNA] X chromosome
>
>
> > I would also like to do this, and you make it sound like second nature,
> > but I'm completely lost.
> --
>
>
> Don't feel bad, everyone is lost at first.
> Again, the spread sheet is here:
>
>
> http://spreadsheets.google.com/ccc?key=0Ah3qUyFYAhKudFA1RGlFTFRiMHpGTU9uN2t3cWJrNFE&hl=en
>
>
> Let us just assume we have two very common sequences that many
> females will have. So you subtract the most common single sequence
> first from your results to see if another common sequence miraculously
> appears.
>
>
> AAGCCCGCTAGGCGCGCCCACTTGA is the most common plain
> vanilla male sequence from left to right but you will need to subtract out
> each position now going from top to bottom like this:
>
>
>
> AG - A = G
> AC - A = C
> AG - G = A
> CC - C = C
> CT - C = T
> CC - C = C
> AG - G = A
> CT - C = T
> CT - T = C
> AG - A = G
> GG - G = G
> AG - G = A
> CC - C = C
> AG - G = A
> AC - C = A
> AG - G = A
> CC - C = C
> CC - C = C
> CT - C = T
> AC - A = C
> CT - C = T
> CT - T = C
> AT - T = A
> GT - G = T
> AG - A = G
>
>
>
> First column is a typical female result combining the two most common
> haplotypes as reported by 23andMe for each position.
> You then subtract out the known common plain vanilla sequence found
> in many men and what do you get?
> Plain Red here GCACTCATCGGACAAACCTCTCATG
>
>
> Most women here have one plain vanilla so that is why it is such
> a useful exercise. This woman has two different haplotypes
> that are already known to be present in our population but just
> needed to be phased (unscrambled). These probably can be
> considered X Haplogroups.
>
>
> If you don't get something common by first subtracting out the
> two sequences above (either Vanilla or Red) then just give me
> your results and I will see what the likely haplogroups are.
>
>
> Hey, I just thought of a rather amusing observation:
> If you subtract a man from a woman you can acquire
> the other woman's X. ;-)
>
>
> Kathy J.
>
>
>
>
>
>
>
>
>
>
> -------------------------------
> To unsubscribe from the list, please send an email to with the word 'unsubscribe' without the quotes in the subject and the body of the message
This thread:
| [DNA] Segments and percentages by Nelda Percival <> |